Lobstr-code

lobSTR: a short tandem repeat profiler for next generation sequencing data

home
download
install
usage
documentation
faq
changelog
genotyping y-str/codis
validation sets
contact-us

Genotyping Y-STR and CODIS markers

The lobSTR reference contains the Y-STR and CODIS markers listed in the table below. These markers were converted from standard nomenclature to hg19 nomenclature using the references given. To see a detailed tutorial on how to genotype these markers, see Best practices for genotyping Y-STR and CODIS markers.

Download bed files with Y-STR and CODIS info:

If you have a set of markers you would like to see added to the reference, or if you have any corrections to the tables below, please contact us.

CODIS

Marker Location (hg19) Motif Nomenclature Reference allele
TPOX chr2:1493425-1493456 AATG [AATG]n 8
D3S1358 chr3:45582231-45582294 TCTG/TCTA [TCTA][TCTG]n[TCTA]m 16
FGA chr4:155508888-155508975 CTTT [TTTC]3[TTTTTTCT]
[CTTT]14CTCC[TTCC]2
22
D5S818 chr5:123111250-123111293 AGAT [AGAT]n 11
CSF1PO chr5:149455887-149455938 AGAT [AGAT]n 13
D7S820 chr7:83789542-83789593 GATA [GATA]n 13
D8S1179 (GATA7G07) chr8:125907115-125907158 TCTA [TCTA]1[TCTG]1[TCTA]n 13
TH01 chr11:2192318-2192345 AATG [AATG]n 7
D13S317 (GATA7G10) chr13:82722160-82722203 TATC [TATC]n 11
Penta E chr15:97374245-97374269 AAAGA [AAAGA]n 5
D16S539 chr16:86386308-86386351 GATA [GATA]n 11
D18S51 chr18:60948900-60948971 AGAA [AGAA]n 18
D21S11 chr21:20554291-20554417 TCTA/TCTG [TCTA]4[TCTG]6[TCTA]3TA
[TCTA]3TCA[TCTA]2TCCATA[TCTA]11
29
Penta D chr21:45056086-45056150 AAAGA [AAAGA]n 13
All CODIS nomenclature was taken from NIST

Y-STRs

The data in this table is described in Table S5 of Gymrek, et al. 2013
Marker Location (hg19) Motif Nomenclature Reference allele Primers
DYS19/DYS394 chrY:9521989-9522052 TATC [TAGA]3TAGG[TAGA]n 15 F:ACTACTGAGTTTCTGTTATAGTGTTTTT
R:GTCAATCTCTGCACCTGGAAAT
DYS385a/b chrY:20842518-20842573
ALT: chrY:20801568-20801824
AGAA [GAAA]n 14 F:AGCATGGGTGACAGAGCTA
R:GCCAATTACATAGTCCTCCTTTC
DYS388 chrY:14747535-14747570 AAT [ATT]n 12 F:GAATTCCATGTGAAGTTAGCCGTTTAGC
R:GAGGCGGAGCTTTTAGTGAG
DYS389I chrY:14612243-14612289 TCTG/TCTA [TCTG]3[TCTA]9 12 F:CCAACTCTCATCTGTATTATCTATG
R:GTTATCCCTGAGTAGTAGAAGAATG
DYS389II chrY:14612242-14612405 TCTG/TCTA [TCTG]5[TCTA]12N48
[TCTG]3[TCTA]9
29 F:CCAACTCTCATCTGTATTATCTATG
R:GTTATCCCTGAGTAGTAGAAGAATG
(DYS389II.1) chrY:14612242-14612310 TCTG/TCTA [TCTG]5[TCTA]12N48
[TCTG]3[TCTA]9
17 F:CCAACTCTCATCTGTATTATCTATG
R:GTTATCCCTGAGTAGTAGAAGAATG
(DYS389II.2) chrY:14612358-14612405 TCTG/TCTA [TCTG]5[TCTA]12N48
[TCTG]3[TCTA]9
12 F:CCAACTCTCATCTGTATTATCTATG
R:GTTATCCCTGAGTAGTAGAAGAATG
DYS390 chrY:17274947-17275042 TCTG/TCTA [TCTG]8[TCTA]11[TCTG]1[TCTA]4 24 F:TATATTTTACACATTTTTGGGCC
R:GTGACAGTAAAATGAAAACATTGC
DYS391 chrY:14102795-14102838 TCTA [TCTA]n 11 F:TTCATCATACACCCATATCTGTC
R:GATAGAGGGATAGGTAGGCAGGC
DYS392 chrY:22633873-22633911 TAT [TAT]n 13 F:TAGAGGCAGTCATCGCAGTG
R:GACCTACCAATCCCATTCCTT
DYS393 chrY:3131152-3131199 AGAT [AGAT]n 12 F:GTGGTCTTCTACTTGTGTCAATAC
F:GAACTCAAGTCCAAAAAATGAGG
DYS406S1 chrY:23843595-23843634 TATC [TATC]n 10 F:CCTGGGTGACACAGTGAGACT
R:TCCACCAAAATTCCATGACA
DYS413a/b chrY:16099088-16099133
ALT: chrY:16167253-16167426
TG [TG]n 23 F:AATGTGTGAGCCAATTGTTTAGAA
R:GAAACTAAACCAAACAGGATACTC
DYS426 chrY:19134850-19134885 GTT [GTT]n 12 F:CTCAAAGTATGAAAGCATGACCA
R:GGTGACAAGACGAGACTTTGTG
DYS434 chrY:14466533-14466568 CTAT TAAT[CTAT]n 9 F:CACTCCCTGAGTGCTGGATT
R:GGAGATGAATGAATGGATGGA
DYS435 chrY:14496298-14496333 TGGA [TGGA]n 9 F:AGCATCTCCACACAGCACAC
R:TTCTCTCTCCCCCTCCTCTC
DYS436 chrY:15203862-15203897 GTT [GTT]n 12 F:CCAGGAGAGCACACACAAAA
R:GCAATCCAACTTCAGCCAAT
DYS437 chrY:14466994-14467057 TCTA [TCTA]10[TCTG]2[TCTA]4 16 F:GACTATGGGCGTGAGTGCAT
R:GAGACCCTGTCATTCACAGATGA
DYS438 chrY:14937824-14937873 TTTTC [TTTTC]n 10 F:CCAAAATTAGTGGGGAATAGTTG
R:GATCACCCAGGGTCTGGAGTT
DYS439 chrY:14515312-14515363 GATA [GATA]n 13 F:TCGAGTTGTTATGGTTTTAGGTCT
R:GTGGCTTGGAATTCTTTTACCC
DYS441 chrY:14981831-14981908 TTCC [TTCC]n 16 F:AAGTTGCAGTGAGCGAAGATTG
R:ATGTACCTGTAGCCCCAGTGAAC
DYS442 chrY:14761103-14761168 TATC/TGTC [TATC]2[TGTC]3[TATC]12 17 F:CCCCAAGTCCCCAAAGTGTGT
R:AAACGCCCATCAATCAATGAGTG
DYS444 chrY:19226192-19226247 TAGA [TAGA]n 14 F:GTGTGAACCATTTGGCATGTTTA
R:TCTAAGGGATCCAAAGGCAGAA
DYS445 chrY:22092602-22092649 TTTA [TTTA]n 12 F:AGTTAAGAGCCCCACCTTCCTG
R:GAGCTGAGATTATGCCACCAAAA
DYS446 chrY:3131458-3131527 TCTCT [TCTCT]n 14 F:TATTTTCAGTCTTGTCCTGT
R:AAATGTATGGCCAACATAGCAAAACCA
DYS447 chrY:15278740-15278854 TAATA/TAAAA [TAATA]6[TAAAA]1[TAATA]
9[TAAAA]1[TAATA]6
23 F:GGTCACAGCATGGCTTGGTT
R:GGGCTTGCTTTGCGTTATCTCT
DYS448 chrY:24365070-24365225 AGAGAT [AGAGAT11N42[AGAGAT]8 19 F:TGGGAGAGGCAAGGATCCAA
R:GTCATATTTCTGGCCGGTCTGG
(DYS448.1) chrY:24365070-24365136 AGAGAT [AGAGAT11N42[AGAGAT]8 11 F:TGGGAGAGGCAAGGATCCAA
R:GTCATATTTCTGGCCGGTCTGG
(DYS448.2) chrY:24365178-24365225 AGAGAT [AGAGAT11N42[AGAGAT]8 8 F:TGGGAGAGGCAAGGATCCAA
R:GTCATATTTCTGGCCGGTCTGG
DYS449 chrY:8218014-8218179 TTTC [TTTC]15[N]50[TTTC]14 27 F:TGGAGTCTCTCAAGCCTGTTCTA
R:CCTGGAAGTGGAGTTTGCTGT
(DYS449.1) chrY:8218014-8218074 TTTC [TTTC]15[N]50[TTTC]14 13 F:TGGAGTCTCTCAAGCCTGTTCTA
R:CCTGGAAGTGGAGTTTGCTGT
(DYS449.2) chrY:8218124-8218179 TTTC [TTTC]15[N]50[TTTC]14 14 F:TGGAGTCTCTCAAGCCTGTTCTA
R:CCTGGAAGTGGAGTTTGCTGT
DYS450 chrY:8126300-8126344 TTTTA [TTTTA]n 8 F:CCAGTGATAATTCAGATGATATG
R:GCCTTTCCAATTTCAATTTCTG
DYS452 chrY:21620478-21620632 TATAC/CATAC [TATAC]2[TGTAC]2
[TATAC]12[CATAC]
[TATAC][CATAC]
[TATAC]3[CATAC]2
[TATAC]3[CATAC][TATAC]3
31 F:GTGGTGTTCTGATGAGGATAATT
R:TTTATTATACTCAGCTAATTAATTGGTT
DYS454 chrY:8224156-8224199 AAAT [AAAT]n 11 F:GACTGACCTCACATTGTTGTTAA
R:GACATGTAGCTCTTCACTTCAC
DYS455 chrY:6911569-6911612 AAAT [AAAT]n 11 F:CTGAGCCGAGAGAATGATAC
R:GGGGTGGAAACGAGTGTTC
DYS456 chrY:4270960-4271019 AGAT [AGAT]n 15 F:GGACCTTGTGATAATGTA
R:CCCATCAACTCAGCCCAAAAC
DYS458 chrY:7867880-7867943 GAAA [GAAA]n 16 F:AGCAACAGGAATGAAACTCCAAT
R:CCACCACGCCCACCCTCC
DYS459a/b chrY:26078851-26078890
ALT: chrY:27883469-27883616
TAAA [TAAA]n 10 F:TTGAGCAACAGAGCAAGACTTA
R:CAGGTGAACTGGGGTAAATAAT
DYS460 chrY:21050842-21050881 ATAG [ATAG]n 10 F:GAGGAATCTGACACCTCTGACA
R:GTCCATATCATCTATCCTCTGCCTA
DYS461 chrY:21050690-21050737 TAGA [TAGA]n[CAGA] 12 F:AGGCAGAGGATAGATGATATGGATAGACAGATA
R:TTCAGGTAAATCTGTCCAGTA
DYS462 chrY:21317047-21317090 TATG [TATG]n 11 F:TGTGCTGTACCAGTTGCCTA
R:CCAGCCTGAGCAAGAGAGTA
DYS463 chrY:7643509-7643628 AAAGG/AAGGG [AAAGG]7[AAGGG]15[AAGGA]2 24 F:AATTCTAGGTTTGAGCAAAGACA
R:ATGAGGTTGTGTGACTTGACTG
DYS472 chrY:16508484-16508507 AAT [AAT]n 8 F:AGATTGTCCCACCTGCACTC
R:GAGGCACTGTGTTCAGCAAA
DYS481 chrY:8426378-8426443 CTT [CTT]n 22 F:AGGAATGTGGCTAACGCTGT
R:ACAGCTCACCAGAAGGTTGC
DYS485 chrY:22099634-22099681 TTA [TTA]n 16 F:CCTGGGTGACAAGAGTTATACTCT
R:GTTTCTTGCAGACTTCGCCACTACATAAT
DYS487 chrY:8914174-8914212 TTA [TTA]n 13 F:TGTGGGAGGCCTTAAGAAAA
R:CCTGGGCAACAGAGAAAGAC
DYS490 chrY:3443765-3443800 TTA [TTA]n 12 F:CTGAGCTGAGATCACGCC
R:GTTTCTTACGATATGAAAAAGCAGTATGTCCT
DYS492 chrY:17414337-17414369 TTA [TTA]n 12 F:AGATGAGCCAGGCTTCAGAC
R:AGTAGGGGTCAGGCACAATG
DYS494 chrY:21386168-21386197 TTA [TTA]n 10 F:TTGCAACACTGTTCATTTGGA
R:AACAAACCTGCATGTTCTTCAA
DYS495 chrY:15011300-15011346 AAT [AAT]n 15 F:AGCAAACTTTGAAGCCAGAAAG
R:GTTTCTTCTTGGGCAACAGAGCGAGA
DYS505 chrY:3640831-3640878 TCCT [TCCT]n 12 F:TCTGGCGAAGTAACCCAAAC
R:GTTTCTTTCGAGTCAGTTCACCAGAAGG
DYS511 chrY:17304923-17304958 GATA [GATA]n 9 F:GATAGGATGGGGTGGATGTG
R:TGTGAATTCCCCTTCTACATCTC
DYS520 chrY:7730432-7730511 ATAG/ATAC [ATAG]n[ATAC]n 20 F:AACAGCCTGCCCAACATAGT
R:GTTTCTTACCATCATGCCCTGCAATA
DYS522 chrY:7415625-7415664 GATA [GATA]n 10 F:CCTTTGAAATCATTCATAATGC
R:GTTTCTTTCATAAACAGAGGGTTCTGG
DYS531 chrY:8466195-8466238 AAAT [AAAT]n 11 F:GACCCACTGGCATTCAAATC
R:TGCTCCCTTTCTTTGTAGACG
DYS533 chrY:18393226-18393273 ATCT [ATCT]n 12 F:CATCTAACATCTTTGTCATCTACC
R:GTTTCTTTGATCAGTTCTTAACTCAACCA
DYS534 chrY:18392976-18393035 CTTT [CTTT]n 15 F:CATCTACCCAACATCCATCTA
R:GTTTCTTGACAAAGATGTTAGATGAATAGACA
DYS537 chrY:19358850-19358889 TCTA [TCTA]n 10 F:GGTCTCCAATTCCATCCAGA
R:TGGAACATGCCCATTAATCA
DYS549 chrY:21520224-21520275 GATA [GATA]n 13 F:AACCAAATTCAGGGATGTACTGA
R:GTCCCCTTTTCCATTTGTGA
DYS556 chrY:22601453-22601496 AATA [AATA]n 11 F:TGCTGTCACATCACCAATG
R:GTTTCTTTTTGGTTGCTGAAGCATTGA
DYS557 chrY:23234712-23234775 TTTC [TTTC]n 16 F:TTTTCTGTGCCAAGCCTACA
R:TCTAATGCACCTTGAGGGATG
DYS565 chrY:16526732-16526775 AATA [AATA]n 12 F:AAACCCAGGAAGCAGTGTTG
R:CCTGGCTCAGCACATGAATA
DYS568 chrY:8822555-8822594 TAAA [TAAA]n 11 F:GTGGCAGACAAAACCCAGTT
R:TTGAAAAGGGATGGGACTCA
DYS570 chrY:6861231-6861298 TTTC [TTTC]n 17 F:GAACTGTCTACAATGGCTCACG
R:TCAGCATAGTCAAGAAACCAGACA
DYS572 chrY:3679660-3679699 AAAT [AAAT]n 10 F:CTAAGGACGCCTCCCATACA
R:CTCATTCCCTATGGTTTGCAC
DYS575 chrY:7436257-7436296 AAAT [AAAT]n 10 F:GGTGGTGGACATCCGTAATC
R:AGTAATGGGATGCTGGGTCA
DYS576 chrY:7053359-7053426 AAAG [AAAG]n 16 F:TTGGGCTGAGGAGTTCAATC
R:GGCAGTCTCATTTCCTGGAG
DYS578 chrY:22562564-22562599 AAAT [AAAT]n 9 F:GAGGCGGAACTTTCAGTGAG
R:GCTTCAACAACCCTGGACAT
DYS589 chrY:24485693-24485757 TTATT [TTATT]n 12 F:CATCCACATTGTTGCAAAGG
R:TGACGAGTTAGTGGGTGCAG
DYS590 chrY:8555980-8556019 TTTTG [TTTTG]n 8 F:GGGAACATAGTCGGGCTGTA
R:GGGTGACAGAGCAAGAATCC
DYS594 chrY:21656837-21656886 AAATA [AAATA]n 10 F:GATGTGCCTAATGCCACAGA
R:GTTTCTTCCCTGGTGTTAATCGTGTCC
DYS607 chrY:18414382-18414457 GAAG [GAAG]15[GAAA][GAAG][GAAA][GAAG] 19 F:AGCATACAGCGTAATCACAGC
R:TCAGACAAAGCCCAGTTGAG
DYS617 chrY:19081518-19081553 TTA [TTAn] 12 F:AGCATGATGCCTTCAGCTTT
R:GGATTGGGGAGTGATAGCAT
DYS635 chrY:14379564-14379655 TCTA/TGTA [TCTA]4[TGTA]2[TCTA]2[TGTA]2
[TCTA]2[TGTA]2[TCTA]9
23 F:ACCAGCCCAAATATCCATCA
R:TGGAATGCTCTCTTGGCTTC
DYS636 chrY:22634857-22634900 TTTA [TTTA]n 12 F:AATCCCATTGCATTTAGCAGA
R:TGACACGTTAGTGGGTGCAG
DYS638 chrY:17645491-17645534 TTTA [TTTA]n 11 F:ACAATTTCCCTTGGGGCTAC
R:CATGGTGGTAGGCACCTGTA
DYS640 chrY:3279702-3279737 TAAA [TAAA]n 9 F:CTGGGCCACAGAGTGAGAC
R:GGGCCAGTCTTTGCAATATC
DYS641 chrY:16134296-16134335 TAAA [TAAA]n 10 F:CTTGAGCCCAGGAAGCATAG
R:GTTTCTTCCACACGATGCAATTTTGTC
DYS643 chrY:17426012-17426066 CTTTT [CTTTT]n 11 F:AAGCCATGCCTGGTTAAACT
R:GTTTCTTTGTAACCAAACACCACCCATT
DYS714 chrY:22147731-22147865 TTTCT/CTTCT/TTTCT [TTTCT]n[CTTCT]n[TTTCT]n
[CTTCT]n[TTTCT]n
27 F:GTATTAGGCCATCTTGCCAGC
R:TTTTCTACCTATGATGCCCTTT
DYS717 chrY:17313245-17313324 GTACT/GTATT [GTACT]m[GTATT]n 16 F:GGCCGAGAGAATGGAATTGAT
R:GTTTCTTCCCGAACTTCAGCACTATGAAATG
GATA-A10 chrY:18718879-18718938 TATC [TCCA]2[TATC]13 15 F:CCTGCCATCTCTATTTATCTTGCATATA
R:ATAAATGGAGATAGTGGGTGGATT
GATA-H4 chrY:18743553-18743600 TAGA [TAGA]n 12 F:ATGCTGAGGAGAATTTCCAA
R:ATGCTGAGGAGAATTTCCAA
DYS395S1a/b chrY:20440393-20440433
ALT: chrY:21279953-21279993
AAC [AAC]n 15
YCAIIa/b chrY:19622111-19622156
ALT: chrY:19016986-19017135
CA [CA]n 23 F:TGTCAAAATTTAACCCACAATCA
R:GCAGTCTTTCACCATAAGGTTAGC
DYS464a/b/c/d chrY:27087611-27087670 (+3 ALT locations) CCTT [CCTT]n 15
Most marker nomenclatures were obtained from NIST. Exceptions are:

Converting lobSTR calls to standard Y-STR/CODIS nomenclature

lobSTR results are given as the number of base pairs length difference from the reference sequence. To conert a lobSTR call at one of these loci to the standard nomenclature, use the simple formula: RefCopyNum + lobSTRAllele/MotifLength. A more in depth tutorial on doing this is at Best practices: Genotyping Y-STRs and CODIS markers.